Skip to main content

Table 1 Primers used for RT-PCR and qRT-PCR in mouse tissue

From: Role of neuromedin B and its receptor in the innate immune responses against influenza A virus infection in vitro and in vivo

Primer names GenBank accession no. Sequence (5′–3′)
NMB sense NM_001291280.1 CGGTCACTTCATGGGCAAG
NMB antisense GAGCTTTCTTTCGCAGGAGGA
NMBR sense NM_008703.3 CATGCGGAATGTCCCTAACATC
NMBR antisense CCAAGCTACCAATGCGTGCTAC
β-actin sense NM_007393.5 AATGGGTCAGAAGGACTCCT
β-actin antisense ACGGTTGGCCTTAGGGTTCAG
IL-6 sense NM_001314054.1 TTGCCTTCTTGGGACTGATG
IL-6 antisense TCTGGCTTTGTCTTTCTTGT
IFN-α sense NM_206871.2 TCCTGCCTGAAGGACAGGAAGG
IFN-α antisense AGGGCTCTCCAGACTTCTGCTCTG
NP sense CY034135.1 TCAAACGTGGGATCAATG
NP antisense GTGCAGACCGTGCTAAAA
  1. The primers designed for the NP gene listed in this table could also be used in human tissues after virus infection.