Skip to main content

Table 1 Primers used in this study

From: HutZ is required for biofilm formation and contributes to the pathogenicity of Edwardsiella piscicida

Primer name Sequence (5′–3′)
HutZKOF1 GGATCCTTAGCGCTGGTGCACAC (BamHI)
HuttZKOR1 TCCAGCAACCACGGCGTCATGCGCGC
HutZKOF2 CGCCGTGGTTGCTGGATGGCGAAGCC
HutZKOR2 GGATCCCAGCATTTCCGGCGCGGAT (BamHI)
HutZF3 ACACATTGCACTGGTTGA
HutZR3 GTACGCTCTTGCGTCAGT
HutZRTF GCAGAGCAGCGGTATGGACTTT
HutZRTR TTCCATCAGGCGGTACATCCA
HutZF5 GAGCTCATGACGCCGTGGATC (SacI)
HutZR5 AAGCTTGCGCACGGGGCGCTC (HindIII)
HutZF1 CATATGATGACGCCGTGGATC (NdeI)
HutZR1 CTCGAGGCGCACGGGGCGCTC (XhoI)
HutWXF AGTGGCAATCCTGCGATTT
HutWXR TGTTGATAAGCGTGGTGACA
HutXZF CGTGTGGTTTATCAACCCTG
HutXZR TGGGCGAGATAGTCATGACC
HutPF4 ATTTAAATGCCCGGACAGGCGCTGAT (SwaI)
HutPR4 ATTTAAATGGTAACTCTCCGTTAATACCTGA (SwaI)
FurF1 GGATCCATGACTGACAACAACACC (BamHI)
FurR1 AAGCTTGGCCTTTTCGTCGTGCA (HindIII)