Skip to main content

Table 2 Primers used in PCR in this work

From: Haemophilus parasuis VtaA2 is involved in adhesion to extracellular proteins

Primer Primer sequence (5′–3′)
HPNK_01698_F GGAGTCATGCTCAACAGGCT
HPNK_01698_R CAGCCTCTTCCTTCCTTCCG
BamHI-vtaAFa GCGCGGATCCTCTTAGTTTTGTGTAACTCTTG
BamHI-vtaARa GCGCGGATCCTTCTAATTTATAGGTGCTAGATTAC
OL-vtaA2F TGGCGATCTAGGACCTACGGGTCCAACGGG AC
OL-vtaA2R CCGTAGGTCCTAGATCGCCATTTAGTTCATT
vtaA2-865F AGCAGTGGCAAGGTAGGC
vtaA2-2655R CTCCATCGGTAAACCGCTG
  1. aBamHI site in primers is underlined.