Skip to main content

Table 2 Genes and primers used in this study

From: The potential of acetylsalicylic acid and vitamin E in modulating inflammatory cascades in chickens under lipopolysaccharide-induced inflammation

Gene Primer Sequence (5′–3′) Melting temperature (°C) Product size (nt) GenBank access no.
ACTB Forward TGTTACCAACACCCACACCC 60.11 110 NM 205518.1
Reverse TCCTGAGTCAAGCGCCAAAA 60.18
COX-1 Forward GCGCATCAGTAGACCTAGCC 60.32 121 JX160009.1
Reverse TGGTATTGTGACAGTGCGGG 60.32
COX-2 Forward TGTCCTTTCACTGCTTTCCAT 57.77 84 NM_001167718
Reverse TTCCATTGCTGTGTTTGAGGT 58.11
LOX-12 Forward CTGATTACGCCGTGCTGGAT 60.53 73 XM_015274997.1
Reverse ATTGGGGCACACAGGAATGT 59.89
CYP450p Forward ACCACTTCTGGAAGGAGGGA 59.81 108 D49803.1
Reverse CGCTCTCGTAGACACCCAAC 60.46
  1. ACTB: β-actin, COX-1: cyclooxygenase-1, COX-2: cyclooxygenase-2, LOX-12: lipoxygenase-12, and CYP450p: cytochrome P450.