Skip to main content

Table 1 Primer sequences of probes used for qPCR analysis

From: Xanthohumol inhibits PRRSV proliferation and alleviates oxidative stress induced by PRRSV via the Nrf2–HMOX1 axis

Primer Sequence (5′ → 3′)
mGAPDH-Fwd 5′ CCTTCCGTGTCCCTACTGCCAA 3′
mGAPDH-Rev 5′ GACGCCTGCTTCACCACCTTCT 3′
mHMOX-1-Fwd 5′ CTTCAAGCTGGTGATGGC 3′
mHMOX-1-Rev 5′ TGGAGCCGCTTCACATAG 3′
mNrf2-Fwd 5′ ATTCAATGATTCTGACTCTG 3′
mNrf2-Rev 5′ CGTATCCCCAGAAGAATGTA 3′
mNQO1-Fwd 5′ CATGTACTCTCTGCAAGGGA 3′
mNQO1-Rev 5′ TCCCAAATATTCTCCAGGCG 3′
mTXNRD1-Fwd 5′ TGTTGTGGGCTTTCACGTAC 3′
mTXNRD1-Rev 5′ ATGTTGTGAATACCTCTGCA 3′
mTNXIP-Fwd 5′ CGACCCTGAAAAGGTGTAC 3′
mTNXIP-Rev 5′ CGAACTTGTACTCATATTTG 3′
mGCLM-Fwd 5′ TCAGTGGGCACAGGTAAAA 3′
mGCLM-Rev 5′ TTGTTTAGCAAATGCAGTCA 3′
mGCLC-Fwd 5′ ACATGCGAAAACGGCGGAA 3′
mGCLC-Rev 5′ CGAGGGTGCTTGTTTATTGC 3′
pHMOX-1-Fwd 5′ GGCTGAGAATGCCGAGTT 3′
pHMOX-1-Rev 5′ ATGTAGCGGGTGTAGGCG 3′
PRRSV-ORF7-Fwd 5′ AAACCAGTCCAGAGGCAAG 3′
PRRSV-ORF7-Rev 5′ TCAGTCGCAAGAGGGAAAT 3′
  1. p means pig and m means monkey