Skip to main content

Table 1 Primer list for 1st round PCR and 2nd round PCR for Tn-seq

From: Tn-sequencing of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis mutant libraries reveals non-essential genes of porcine mycoplasmas differing in pathogenicity

No Primer Sequence
1 NGS_1st_Seq6 GACTTGAGCGTCGATTTTTGTG
2 NGS_1st_PCR_rev_1 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-NNNNNNNNNN-TGATT
3 NGS_1st_PCR_rev_2 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-NNNNNNNNNN-TTGAT
4 NGS_1st_PCR_rev_3 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-NNNNNNNNNN-TTTAG
5 NGS_1st_PCR_rev_4 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-NNNNNNNNNN-CAGG
6 NGS_1st_PCR_rev_5 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-NNNNNNNNNN-TTCCC
7 NGS_1st_PCR_rev_6 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-NNNNNNNNNN-TCAGC
8 Seq7_NGS_tail_F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-GTTGCGGTACCCTTTTACAC
9 NGS_tail_R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG