Skip to main content

Advertisement

Table 1 Oligonucleotides used for mutagenesis and positions of the point mutations in strain r1_445

From: Amino acidic substitutions in the polymerase N-terminal region of a reassortant betanodavirus strain causing poor adaptation to temperature increase

Oligonucleotide sequence (5′ to 3′)a nt substitutionb aa substitution
AGGATTATCGCCAACGCGTCATCGCTGAGAAGAAA A-199 → G Iso-41 → Val
CGCGTCATCGCTGAGAAGAAACAAATTCTCCGTGATGC G-220 → A Val-48 → Iso
CCCGACCTCGAGGTTTCTGGGCGAATC C-730 → T Leu-218 → Phe
GAGGTTTCTGGGCGAATCTGATGCAGATCCTG T-745 → A Leu-223 → Met
GTCACCGCGATCTGTAGTTTTCTTTACACCAAGC A-791 → T Thr-238 → Phe
CAAGATCAGTGAGTATGGTGCTGAGTTGGAGTATATGCG A-943 → G Thr-289 → Ala
  1. aNucleotides used for mutagenesis are underlined.
  2. bPositions in SpSsIAusc160.03 RNA1 genome (GenBank accession no. NC_024492.1).