Skip to main content

Advertisement

Table 1 DNA oligonucleotides

From: Mycoplasma hyopneumoniae evades phagocytic uptake by porcine alveolar macrophages in vitro

Name 3′ sequence 5′
gfpF TTACTAGTTGTGTGGAATTCGAGCTCGG
gfpR TTGCATGCCTGCAGGTCTGG
P97F GTCACGCGTCTTTTAATTATTAGTCTTCC
P97R GTCGGATCCTTACTCATATTTTAAACCTC
  1. Underlined nucleotides indicate restriction enzyme sequence