Skip to main content

Table 2 Primer sequences for real-time quantitative PCR

From: UBXN1 interacts with the S1 protein of transmissible gastroenteritis coronavirus and plays a role in viral replication

Gene Accession number Sequence (5′–3′) Size (bp) Concentration
β-Actin XM_003124280.2 F: CTCTTCCAGCCCTCCTTCC 97 0.5 µM
R: GGTCCTTGCGGATGTCG
UBXN1 XM_003353824.1 F: TTGGAGCTTGTGGCCCAGAA 139
R: GGCGCATTTCGTCTTCCTGG
TGEV-N NC_038861.1 F: TTCAACCCCATAACCCTCCAACAA 136
R: GGCCCTTCACCATGCGATAGC