Skip to main content

Table 1 Primer table.

From: Newcastle disease virus selectively infects dividing cells and promotes viral proliferation

Name Forward primer (5′–3′) Reverse primers (5′–3′)
NDV M gene [26] AAGAAGCAAATCGCCCC ACGCTTCCTAGGCAGAG
Human Caspase-3 TGCATACTCCACAGCACCTG TTCTGTTGCCACCTTTCGGT
Human Caspase-9 AGCAGCAAAGTTGTCGAAGC TTCTGCTCGACATCACCAAA
Human AKT1 ACTGTCATCGAACGCACCTT CTCCTCCTCCTCCTGCTTCT
Human Bcl2 GAACTGGGGGAGGATTGTGG GCCGGTTCAGGTACTCAGTC
NDV-specific reverse-transcription primer [26] AGGGTTCCCGTTCATTCAG