Skip to main content

Advertisement

Table 2 Sequence of primers used for Q-PCR analysis

From: Bovine fetal mesenchymal stem cells exert antiproliferative effect against mastitis causing pathogen Staphylococcus aureus

Gene Sense antisense Accession number
Housekeeping genes
 GAPDH CCTTCATTGACCTTCACTACATGGTCTA TGGAAGATGGTGATGGCCTTTCCATTG NM_001034034.2
 βACTIN CGCACCACTGGTATTGTCAT TCCAAGGCGACGTAGCAGAG NM_173979.3
Antimicrobial peptides genes
 bBD4A GCCAGCATGAGGCTCCATC GGCACAAGAACGGAATACAGA NM_174775.1
 NK1 CCAGCAAGAATGTCATCATCC GTCCTTAGAGATGCGATTGAGATAC NM_001046578.1
 CATHL2 GGATTGGTGGACGAAATCTG GAATGGGCTGGTGAAACAGT NM_174826.3
 HEP GACAGACGGCACAATGGCAC TGGAGGGCAGCAGGAATAAATA NM_001114508.2
 IDO CGAATATACTTGTCTGGTTGG GGAGAACATCAAAGCACTG NM_001101866.2