Skip to main content

Advertisement

Table 1 Primer sequences and amplicon details used in RT-qPCR assay for Flavobacterium columnare

From: Evidence that the stress hormone cortisol regulates biofilm formation differently among Flavobacterium columnare isolates

Primer name Sequence (5′–3′) Amplicon length (bp) Efficiency (%) R2 (%) References
Primers for target genes (gld-genes are involved in motility, spr-genes in adhesion and porV in virulence)
 FC_gldK_fwd GCCAAATAGCACCCTCTATCA 102 103.0 98.9 This study
 FC_gldK_rev AACAGAAGCCGAATGGGAATA
 FC_gldL_fwd GCTTCTGTACCTAAACCAGCA 94 99.9 99.5 This study
 FC_gldL_rev TTGGTGCGGCAGTAGTAATC
 FC_gldM_fwd ACTACCACATCACCTCTTTGTG 93 102.4 99.2 This study
 FC_gldM_rev TCCAGGGCAACCAACAATAG
 FC_gldN_fwd GCAAGCGCTATGCTTATTGCTGGT 131 97.8 99.0 [31]
 FC_gldN_rev GCAGTTGGTTGTCCCCCTGCT
 FC_sprA_fwd AGGCGATGGTATTTCGTTAGG 122 101.9 99.5 This study
 FC_sprA_rev GTACGCGTCCTGCTTGATAA
 FC_sprE_fwd AGCCGTGCAGAAGATAAAGC 151 92.4 99.0 [31]
 FC_sprE_rev ACGCTTCTAATGCGGGTACAA
 FC_sprT_fwd AACCAGGACTGCATTACGGA 144 91.1 99.2 [31]
 FC_sprT_rev GCTTGATGTTACCTGTGCGTT
 FC_porV_fwd GTGCCAACTCCTAAAACAGCC 152 102.7 99.3 [31]
 FC_porV_rev AAACCTCCTGGAGCATCACC
Primers for reference genes
 FC_16S_fwd ACGATCAAACGGCCATTG 119 105.0 99.4 [30]
 FC_16S_rev AGTAACCTGCCTTCGCAATC
 FC_gap1_fwd ACCATCCCAAACAGGAGCCGC 98 103.3 99.3 [30]
 FC_gap1_rev CGTCTGCTGTAGGTACGCGCA
 FC_glyA_fwd CCAAACCCTTGGGGCTATACAACCC 98 103.2 99.6 [30]
 FC_glyA_rev AGAGGGCCTCCTTGATTACCTGGAA
 FC_rplQ_fwd AGCTGCTAAAGTAGGTGACCGTCC 75 96.7 99.1 [30]
 FC_rplQ_rev GCGTTATCTCCTAAACGGTTCCCCA
  1. Amplicon length, efficiency, and R2 are given for a primer pair consisting of a forward (fwd) and a reverse (rev) primer.