Skip to main content

Advertisement

Table 1 Primers used in this study

From: PCV2 replication promoted by oxidative stress is dependent on the regulation of autophagy on apoptosis

Gene Primer sequence (5′-3′)
β-actin F: CTGCGGCATCCACGAAACT
R: AGGGCCGTGATCTCCTTCTG
Caspase-3 F: GGAATGGCATGTCGATCTGGT
R: ACTGTCCGTCTCAATCCCAC
Caspase-8 F: TCTGCGGACTGGATGTGATT
R: TCTGAGGTTGCTGGTCACAC
Bax F: ATGATCGCAGCCGTGGACACG
R: ACGAAGATGGTCACCGTCGC
Bcl-2 F: GAAACCCCTAGTGCCATCAA
R: GGGACGTCAGGTCACTGAAT