Skip to main content

Table 1 Primers used for qPCR and PCR amplification

From: 14-3-3ε acts as a proviral factor in highly pathogenic porcine reproductive and respiratory syndrome virus infection

Types Name Sense (5′–3′) Antisense (5′–3′)
siRNA Epsilon-29 GCUGAGCGAUACGACGAAATT UUUCGUCGUAUCGCUCAGCTT
Epsilon-159 GGAGAAUAAUCAGCAGCAUTT AUGCUGCUGAUUAUUCUCCTT
Epsilon-643 GCAGUUGUUACGUGAUAAUTT AUUAUCACGUAACAACUGCTT
Beta-21 GCUGGUACAGAAAGCCAAATT UUUGGCUUUCUGUACCAGCTT
Beta-138 CUCUGUUGCCUACAAGAAUTT AUUCUUGUAGGCAACAGAGTT
N.C UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
qPCR primers 14-3-3β TGAGAAGAAGCAGCAGATG TTCCGATGTCCACAGAGT
14-3-3ε CGACGAAATGGTGGAGTC TGCTGGAATGAGGTGTTT
PRRSV N gene AGATCATCGCCCAACAAAAC GACACAATTGCCGCTCACTA
GAPDH (swine) ACTCACTCTTCCACTTTTGATGCT TGTTGCTGTAGCCAAATTCA
GAPDH (monkey) ACCCACTCTTCCACCTTCGACGCT TGTTGCTGTAGCCAAATTCG