Skip to main content

Advertisement

Table 2 Primers used for immune gene analysis

From: Piscine orthoreovirus subtype 3 (PRV-3) causes heart inflammation in rainbow trout (Oncorhynchus mykiss)

Gene Primer sequences Amplicon length Reference Gene Bank No.
Elongation Factor (EF1a) GATCCAGAAGGAGGTCACCA
TTACGTTCGACCTTCCATCC
150 [43] AF498320.1
Mx AGCTCAAACGCCTGATGAAG
ACCCCACTGAAACACACCTG
142 [43] NM_001171901
Viperin ACGACCTCCAGCTCCCAAGT
GTCCAGGTGGCTCTTCCTGC
173 [43] AF076620.1
Interferon type 1 AAAACTGTTTGATGGGAATATGAAA
TGTTTCAGTCTCCTCTCAGGTT
141 [43] NM_001124531
Interferon gamma CAAACTGAAAGTCCACTATAAGATCTCCA
GGTCCAGCCTCTCCCTCAC
188 [44] FM864345.1
CD-4 CCTGCTCATCCACAGCCTAT
CTTCTCCTGGCTGTCTGACC
111 [43] AY973030.1
CD-8 alpha AGTCGTGCAAAGTGGGAAAG
GGTTGCAATGGCATACAGTG
123 [43] NM_001124263