Skip to main content

Table 1 Primers used for construction of the rNDV expressing IBV S protein vaccine candidates

From: Development of a recombinant Newcastle disease virus-vectored vaccine for infectious bronchitis virus variant strains circulating in Egypt

Primer number

Primer name

Primer sequence

1

COS-2167F (SmaI)a

ACTCTGAAAGACCTGATCTGCG

2

COS-(YA) Rev

AGTTGTGGCGTAGGAGCTTTTCb

3

COS-(YA) Fwd

AGCTCCTACGCCACAACTTTTGc

4

COS-R (StuI-PmeI-Fct12)

AGGCCTGTTTAAACTCACATTTTAGTGGTTGCCCTCATTTGATCCAAAGTGTTCACTGATTTCTTGGGTCTGTACd

5

COSΔct-R (StuI-PmeI-Fct12)

AGGCCTGTTTAAACTCACATTTTAGTGGTTGCCCTCATTTGATCCAAAGTGTTAAAGAAGATCCACCCCAGGATCe

  1. aThe primer sequence is just upstream to the naturally present SmaI sequence at the nt position 2167 of the codon-optimized S gene sequence.
  2. bThe sequence “GGC” in bold indicates the reverse complementary mutagenic sequence of alanine residue at nt position 3433–3435 of the codon-optimized S gene sequence.
  3. cThe sequence “GCC” in bold indicates the mutagenic sequence of alanine residue at nt position 3433–3435 of the codon-optimized S gene sequence.
  4. dUnderlined sequence indicates StuI, italicized sequence in indicates PmeI, sequence in regular font indicates nt coding for optimized last 12 aa of NDV F protein, sequence in bold indicates the N terminus of IBV S specific sequence.
  5. eUnderlined sequence indicates StuI, italicized sequence indicates PmeI, sequence in regular font indicates nt coding for optimized last 12 aa of NDV F protein, sequence in bold indicates the N terminus of the transmembrane domain of IBV S specific sequence.