Skip to main content

Table 1 Primer sequences for qPCR

From: Saccharomyces cerevisiae mannan induces sheep beta-defensin-1 expression via Dectin-2-Syk-p38 pathways in ovine ruminal epithelial cells

Gene names GenBank accession Fragment size (bp) Primer pair sequences (5ʹ–3ʹ)
β-Actin U39357 208 F: GTCACCAACTGGGACGACA
R: AGGCGTACAGGGACAGCA
SBD-1 U75250 133 F: GCTCTTCTTCGTGGTCCTGT
R: ACAGGTGCCAATCTGTCTCA
Dectin-2 AM167931.1 146 F: GAGTGAGCAGAATTGCGTTG
R: ATTGCCAGTTGCCATTCC
Syk XM_004004064.3 139 F: GGAGGAGGCGGAAGACTACCTG
R: CCTCTCGATGGTGTAGTGATGTGC
p38 NM_001142894.1 74 F: CGTTCAGTTCCTTATCTACCAG
R: GCTCACAGTCTTCATTCACAG
ERK1/2 XM_012157699.1 90 F: GCGCTACACCAATCTCTCGT
R: ATGGCGACTCGGACTTTGTT
JNK XM_004002020.3 113 F: ATGACTGCAAAGATGGAAACGA
R: ATGCTCTGCTTCAGAATCTTGG
NF-κB XM_012159302.1 107 F: AGCACAAGAAGGCAGCACAA
R: CCATCAGCAGCAGCAGACA