Skip to main content

Table 1 Primers used in this study

From: Global discovery of small RNAs in the fish pathogen Edwardsiella piscicida: key regulator of adversity and pathogenicity

Primer Sequences (5′ → 3′)
sR012KOF1 GGATCCAGTCCCTCTCTTCGCA (BamHI)
sR012KOR1 AGGCAAGTTACGACGCAAGTATTGCA
sR012KOF2 GCGTCGTACTTGCCTGTCGGCAGGT
sR012KOR2 GGATCCGCGCAGCAAATCGTCGT (BamHI)
sR043KOF1 GGATCCTCGAGCCGTGAACTGTT (BamHI)
sR043KOR1 ATAGATCGCTGCGTAAAAAATGCGCA
sR043KOF2 TTACGCAGCGATCTATTTGGTGAATGGT
sR043KOR2 GGATCCATTCAAACTCGCTCAGGT (BamHI)
sR082KOF1 GGATCCGCCTTTGCTCCAGATAAT (BamHI)
sR082KOR1 CAAATACCCGGAAAAGCCCATACAAT
sR082KOF2 CTTTTCCGGGTATTTGCTGGCCTATCCT
sR082KOR2 GGATCCAGCCACTGAATAGCGAAG (BamHI)
SR084KOF1 GGATCCTGGAACGAGATCGAGAT (BamHI)
SR084KOR1 ACGCAAAAAGCAATGGGGATATTGTCT
SR084KOF2 CCATTGCTTTTTGCGTCCGCGTTCT
SR084KOR2 GGATCCATCCCGATACCCGACAA (BamHI)
SR114KOF1 GGATCCGGTGTCGTGGCTTGAAGT (BamHI)
SR114KOR1 TTTACCAAAGCTCATTGCCTATTTGGAT
SR114KOF2 AATGAGCTTTGGTAAACAGGTGGTGTTT
SR114KOR2 GGATCCCACAAACCCAGCAAGCGCT (BamHI)
SR145KOF1 GGATCCCTGCGACCTTGTCCGTT (BamHI)
SR145KOR1 CGCACAGAACGCTATTCTGACGCATT
SR145KOF2 AATAGCGTTCTGTGCGACATGTCGTT
SR145KOR2 GGATCCTGGATTTCGAACTCTACGT (BamHI)
SR274KOF1 GGATCCTCATCCGTAAATGGGTGAT (BamHI)
SR274KOR1 CCGAAAAGGCAATCAGCGCTACGCAT
SR274KOF2 CTGATTGCCTTTTCGGCCTGGTTCT
SR274KOR2 GGATCCCACAGGAAGGGCGAT (BamHI)
SR318KOF1 GGATCCCTGGTAGGTCGTGCCA (BamHI)
SR318KOR1 AATGAGCCATCCCCTGTCGTCTTCCT
SR318KOF2 CAGGGGATGGCTCATTATCTCACAGGCA
SR318KOR2 GGATCCCTTCTACCTGGCGCTGAT (BamHI)
SR355KOF1 GGATCCTGTGGCGGTGCAGCATT (BamHI)
SR355KOR1 TCGCACTTGAACGTGCACCGGCCT
SR355KOF2 GCACGTTCAAGTGCGAGCCGCGCAAT
SR355KOR2 GGATCCGTCATGCGCAGGGTTT (BamHI)