Skip to main content

Table 1 Primer sequences, position in gene, accession number in GenBank, and product sizes used in qPCR

From: Small ruminant lentivirus infection influences expression of acute phase proteins and cathelicidin genes in milk somatic cells and peripheral blood leukocytes of dairy goats

Gene name Gene symbol Primer sequence Product size (bp) GenBank/UniProt assessiona References
Serum amyloid A3 protein SAA F CTGGGCTGCTAAAGTGATCAGTAAC 69 EU884570.1 [59]
R CCCTTGAGCAGAGGGTCTGTGATT
Haptoglobin Hp F TAATGCCCATCTGCCTAC 162 XM_005692202.3 [60]
R CGCCCTCATAGTGTTTCA
C-reactive protein CRP F CTGGCTTGGGAGATTG 134 XM_018046353.1 [60]
R AGTGAGGGTAAGGGATT
α-lactalbumin LLBA F TGACATTTGTGTGTGCCAAGA 198 NM_001285635.1 PRIMER3b
R CAAGGGGGTACAAAGAAGCA
α-acid glycoprotein AGP F TTGCTTGGCTGCAGGTGT 197 XM_012152252.2 [11]
R CAATGGTCTGGTACTCTCTCTG
Ceruloplasmin Cp F GAGCATGAAGGGGCCATTTATC 130 NM_001256556.1 [61]
R GCTGTCTTCCTCACCAGG
Fibrinogen α chain Fbα F TGAGATCCTGAGGCGCAAAG 104 NM_001033626.1 [61]
R TGTCCACCTCCAATCGTTTCAT
Fibrinogen β chain Fbβ F GACAACGACGGCTGGAAAAC 124 NM_001142917 [61]
R ACGCTCCACCCCAGTAGTAT
Fibrinogen ɣ Fbɣ F TGCCAATAAGGGGGCCAAAG 134 NM_173911 [61]
R GACTGCCATCAAGCCTCTTCT
Bactenecin-5; cathelicidin-2 BAC5 F GTGGAATTCACGGTGAAGGAGAC 390 Y18873.1 [52]
R CTCAGGCCAAATGAGAT
Bactenecin-7.5; cathelicidin-3 BAC7.5 F GTGGAATTCACGGTGAAGGAGAC 383 AJ243125.1 [52]
R AGTGCTAACCTTGATGTT
Cathelicidin-6 MAP28 F GTGGAATTCACGGTGAAGGAGAG 225 AJ243126.1 [52]
R AATTGGGCCGACTTTGTGCC
Cathelicidin-7 MAP34 F ACCGAATTCAGCTACAGGGAGGCCGT 428 AJ243127.1 [52]
R ACCTGATCCTTAGGACTTC
  1. bp: base pairs, F: forward primer, R: reverse primer.
  2. aNCBI [62].
  3. bPRIMER3 [63].