Skip to main content

Table 1 Primers used in this work

From: Newcastle disease virus V protein inhibits apoptosis in DF-1 cells by downregulating TXNL1

Primer Primer sequence (5 to 3)
TXNL1-F CGGAATTCATGGTGGGCGTGAAGCTGAT
TXNL1-R TTGCGGCCGCTTAGTGGCTCTCTCCTTTTT
Q-TXNL1-F TCGCTAACGACACCGAGTTC
Q-TXNL1-R TTCTAACCCCACAGCATCCG
Q-Bcl2-F CTTCCGTGATGGGGTCAACT
Q-Bcl2-R AGGTACTCGGTCATCCAGGT
Q-Caspase3-F CCATGGCGATGAAGGACTCT
Q-Caspase3-R CCCGCTAGACTTCTGCACTT
Q-FasL-F GAGGTGTTGACCCACGTTGT
Q-FasL-R AGTTGATGCGCTTGTCCTCC
Q-Caspase9-F GCTTGTCCATCCCAGTCCAA
Q-Caspase9-R CAGTCTGTGGTCGCTCTTGT
Q-NDV-F TCCCAAGCGCGAGTTACTTT
Q-NDV-R TTGTTCGCCACGACCATACA
Q-βactin-F TTACCCACACTGTGCCCATC
Q-βactin-R GGGCACCTGAACCTCTCATT