Skip to main content

Table 2 Primers used for the qPCR carried out with the RNA extracted from MFG

From: Host factors determine the evolution of infection with Staphylococcus aureus to gangrenous mastitis in goats

Genes Primers Sequence 5′–3′ Amplicon (bp)
Ccl5 Forward
Reverse
ACC AGC AGC AAG TGC TCC AT
CGC ACA CCT GAC GGT TCT T
86
Cd68 Forward
Reverse
GAT CTG CTC TCC CTG AAG CTA CA
CAT TGG GAC AAG AGA AAC TTG GT
79
Csn1s2 Forward
Reverse
CTG GTT ATG GTT GGA CTG GAA AA
AAC ATG CTG GTT GTA TGA AGT AAA GTG
76
Il17a Forward
Reverse
GCC CAC CTA CTG AGG ACA AG
GCT GGA TGG TGA CAG AGT TC
246
Il17f Forward
Reverse
CACTCTGGAGGACCACATTG
GAGTTCAGGGTCCTGTCTTC
216
Il1a Forward
Reverse
CTG AAG AAG AGA CGG TTG AG
ATG CAT TCC TGG TGG ATG AC
164
Il1b Forward
Reverse
GAC AAC AAG ATT CCT GTG GCC
TCT ACT TCC TCC AGA TGA AGT GT
101
Il8 Forward
Reverse
TGA GAG TGG GCC ACA CTG C
CAC AAC CTT CTG CAC CCA CTT
103
MIF Forward
Reverse
GCG CCT GCG ATT AGC
CGC GTT CAT GTC GCA GAA
55
PTX3 Forward
Reverse
CCG AGC TGT GCA GGG CT
GCA CGC TTG CAA AAA TCT TCT T
101
PPIA Forward
Reverse
TGA CTT CAC ACG CCA TAA TGG T
CAT CAT CAA ATT TCT CGC CAT AGA
62
RPS24 Forward
Reverse
TGG TGGTGG CAA GAC AAC TG
TTC TTC GCG TAA TCC AAG GAA
66
  1. Gene names: C–C motif chemokine ligand 5 (CCL5); Alpha-S2-casein (CSN1S2); Macrophage migration inhibitory factor (MIF); Pentraxin 3 (PTX3); Peptidylprolyl isomerase A (PPIA); Ribosomal protein S24 (RPS24).