Skip to main content

Table 1 Bacterial strains and plasmids used in this study

From: Potent O-antigen-deficient (rough) mutants of Salmonella Typhimurium secreting Lawsonia intracellularis antigens enhance immunogenicity and provide single-immunization protection against proliferative enteropathy and salmonellosis in a murine model

Strain/plasmid Description Reference
S. Typhimurium
 JOL990 S. Typhimurium wild type, challenge strain Lab stock
 JOL1800 Salmonella Typhimurium ∆lon, ∆cpxR, ∆asd, ∆rfaL; bacterial delivery vector; rough strain Lab stock
 JOL1809 JOL1800 containing pJHL65 and expressing OptA This study
 JOL1810 JOL1800 containing pJHL80 and expressing OptB This study
 JOL1811 JOL1800 containing pJHL65 and expressing FliC This study
 JOL1812 JOL1800 containing pJHL65 and expressing Hly This study
E. coli
 BL21(DE3)pLysS F, ompT, hsdSB (r B , m B ), dcm, gal, λ (DE3), pLysS, Cmr Promega
 JOL232 F λ ϕ80 ∆(lacZYA-argF) endA1 recA1 hadR17 deoR thi-1 glnV44 gyrA96 relA1 ∆asdA4 Lab stock
 JOL1601 JOL232 containing pJHL80-OptA This study
 JOL1902 JOL232 containing pJHL65-OptB This study
 JOL1658 JOL232 containing pJHL65-FliC This study
 JOL1743 JOL232 containing pJHL65-Hly This study
Plasmids
 pET28a(+) IPTG-inducible expression vector; Kanamycin resistant Novagen
 pET32a IPTG-inducible expression vector; Kanamycin resistant Lab stock
 pET-optA pET32a derivative containing optA This study
 pET-optB pET28a(+) derivative containing optB This study
 pET-fliC pET28a(+) derivative containing fliC This study
 pET-hly pET28a(+) derivative containing hly This study
 pJHL65 asd+ vector, pBR ori, β-lactamase signal sequence-based periplasmic secretion plasmid, 6xHis, high copy number [24]
 pJHL80 asd+ vector, p15A ori, β-lactamase signal sequence-based periplasmic secretion plasmid, 6xHis, high copy number  
 pJHL-OptA pJHL80 harboring optA of L. intracellularis This study
 pJHL-OptB pJHL65 harboring optB of L. intracellularis This study
 pJHL-FliC pJHL65 harboring fliC of L. intracellularis This study
 pJHL-Hly pJHL65 harboring hly of L. intracellularis This study
Primers
 rfaL DEL OT F 5′-GGATACGATAAACCGCAGTCG This study
 rfaL DEL OT R 5′- AACCGTGCGCTTGCTGATAAG This study
 rfaL DEL IN F 5′- ACAAGTTTAGGACTTCGCTGCC This study
 rfaL DEL IN R 5′-CAGAATGGTATTATGCGGACCG This study