Skip to main content

Advertisement

Table 1 Primers used for validation of differentially expressed (DE) genes in Mycoplasma suis -infected pigs by quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR)

From: RNA-Seq based transcriptome of whole blood from immunocompetent pigs (Sus scrofa) experimentally infected with Mycoplasma suis strain Illinois

  Gene symbol Gene description Primer forward (5′–3′) Primer reverse (5′–3′) Amplicon length (bp)
Reference gene GAPDH   TTGGCTACAGCAACAGGGTG CAGGAGATGCTCGGTGTGTT 166
DE genes ISG15 ISG15 ubiquitin-like modifier ATGTGCTTCAGGATGGGGTG AGGATGCTCAGTGGGTCTCT 100
  IL22RA2 Interleukin 22 receptor, alpha 2 ACCAGCAACAGCAGCATCTA TGAGTGCATCCCAGCCAAG 177
  CD274 CD274 molecule TTACCCAGAGGCCGAAGTCA TCCTCTCTCTGGGAACTGGT 87
  BCL2L14 BCL2-like 14 (apoptosis facilitator) TGCCTACAGGGTTCCGTTTC TTCGTGGTCTAAGCGCTGTT 113
  CCR5 Chemokine (C-C motif) receptor 5 CAGTGGGTCTAACAGGCTGG GCGTCTGACGATGTGCTTTC 151
  CD180 CD180 molecule TGCTCATCGTCCTGCTCATTT CCAGCTCCAGGAACCAATCT 178
  AIF1 Allograft inflammatory factor 1 GCGAGAGAACAGGAAAAGCC AGCCCCTTCAATTCCACCAC 100
  IL15 Interleukin 15 GCTCATCCCAATTGCAAAGT TTCCTCCAGCTCCTCACATT 189 [37]
  PTPRO Protein tyrosine phosphatase, receptor type, O AAGCACCAGGACGACTTAGC AACCCCAAAACTCAGCCCAA 174
  TLR8 Toll-like receptor 8 CGGAAGGCTTGTTTTGGCAA CGACCAAACATCACCGAGGA 112