Skip to main content

Advertisement

Table 1 Primers for selected genes analyzed with qRT–PCR

From: Binding and entry of peste des petits ruminants virus into caprine endometrial epithelial cells profoundly affect early cellular gene expression

Gene symbol Primer sequence (5ʹ–3ʹ) GenBank accession Product (bp)
TNF AGGTCAACATCCTCTCTGCC NM_001286442 169
CCAAAGTAGACCTGCCCAGA   
NFκBIα GTTGAAGTGTGGGCTGATG XM_013973127 173
TCATCGTAGGGAAGCTCGTC   
CXCL1 AACATGCAGAGCGTGAAGGTGAC NM_001009358 158
CAGTTGGAGCTGGCCTGGTTT   
JUNB ACACCAACCTCAGCAGCTAT XM_005682285 153
TCTGCGGTTCCTCCTTGAAG   
IL1α TCTGGAGGCAGTGAAAT XM_005686666 191
AGACCCATGCTTTTCCCAGA   
TGFβ3 TTCCGCTTCAACGTGTCCTCA XM_005686141 161
TACCGCTGCTTGGCTATGTGC   
TLR4 GAGCACCTATGACGCCTTTG HQ263215 165
CTCTGGATGAAAGTGCTGGGA   
NFκBIβ TGCCCTGTACTGAACCTG XM_018062371 192
GGTTTGTTGAGGTCAGCTCC   
SMAD7 GGCTGTGTTGCTGTGAATCT XM_005697186 105
GCCGATTTTGCTCCGTACTT   
HSP90AA1 GCCCTGGACAAGATCAGGTA XM_018066239.1 151
TAATCAAATCGGCCTTGGTC   
GAPDH GATGGTGAAGGTCGGAGTGAAC XM_005680968.1 100
GTCATTGATGGCGACGATGT