Skip to main content

Advertisement

Table 3 Primers used in this study

From: Identification and characterization of serovar-independent immunogens in Actinobacillus pleuropneumoniae

Primer Sequence (5′– > 3′)
degS_left_for GAATTCCTGCAGCCCGCGAACGGCTAAATCTATATGATG
degS_left_rev CCAAGGTTGAAACGAAACCTAGTGCAATCGCTTGTAC
degS_right_for TTGACGGAGGGCTTTGGCGAATTTCCGGAACTATAATGC
degS_right_rev ACTAGTGGATCCCCCCGCAACCTCACGATTTCTATCTC
nlpI_left-for GAATTCCTGCAGCCCGCGTGATGGAACAAGCGATTC
nlpI_left-rev CCAAGGTTGAAACGAGCATCAAGAAGCGAAGGTGAAAC
nlpI_right-for TTGACGGAGGGCTTTACGTGGTGGTAGCAATGTTG
nlpI_right-rev ACTAGTGGATCCCCCTTGTAGTGCAGAGAGGTCTAACG
dfrA14-degS_for CGATTGCACTAGGTTTCGTTTCAACCTTGGTGTTTGG
dfrA14-degS_rev TTCCGGAAATTCGCCAAAGCCCTCCGTCAAATTTATTACC
dfrA14-nlpI_for TTCGCTTCTTGATGCTCGTTTCAACCTTGGTGTTTGG
dfrA14-nlpI_rev TTGCTACCACCACGTAAAGCCCTCCGTCAAATTTATTACC
degS_test AATAATGACCGAACACATCC
nlpI_test ATTTCGTCCGCTTCATCC
dfrA14_test-for TCGTTTCAACCTTGGTGTTTGG
dfrA14_test-rev AAAGCCCTCCGTCAATTTTATTACC
apfA_pET44_for GTCCCaCGaGGaAGCCAgAAgCTAAGTCTTATTCGACCa
apfA_pET44_rev ACTTcATTAACATTAGTTTATCGCgCAGAAATTTGCC
pET44_apfA_rev AAGACTTAGcTTcTGGCTtCCtCGtGGGACCAG
pET44_apfA_for TTCTGcGCGATAAAcTAATGTTAATgAAGTTGGGCGTTCCT
vacJ_pET44_for GTCCCaCGaGGaAGCAAgTTAAAgCAATTAAGgTTAGTAGCC
vacJ_pET44_rev ACTTcATTAACATTAATCAATgTCTTTcAATTCTTCTTCGG
pET44_vacJ_rev TAATTGcTTTAAcTTGCTtCCtCGtGGGACCAG
pET44_vacJ_for TTgAAAGAcATTGATTAATGTTAATgAAGTTGGGCGTTCCT
  1. Lower case letters indicate nucleotides modified from the target sequence in order to reduce primer secondary structure formation.