Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Crosstalk between H9N2 avian influenza virus and crypt-derived intestinal organoids

Target genes Primer sense (5′–3′) Primer antisense (5′–3′) Product size (bp)
HA AGACCATCGGCTGTTAATGG TTGTGTATTGGGCGTCTTGA 235
NA TTCAGGCAGAATGAATGCAG TGCGGAAAGCCTAATTGAGT 213
NP GAAATCCTGGGAATGCTGAA AACACCTGGCTGTTTTGGAG 202
PB1 AGCGGGTATGCACAAACAGA ATAAGTCTGGCGACCTTGGG 150
mLyz1 GCCAAGGTCTACAATCGTTGTGAGTTG CAGTCAGCCAGCTTGACACCACG 290
mDefa6 CCTTCCAGGTCCAGGCTGAT TGAGAAGTGGTCATCAGGCAC 317
mDefcr1 TCAAGAGGCTGCAAAGGAAGAGAAC TGGTCTCCATGTTCAGCGACAGC 280
mWnt3 CTCGCTGGCTACCCAATTTG CTTCACACCTTCTGCTACGCT 165
mAxin2 TGACTCTCCTTCCAGATCCCA TGCCCACACTAGGCTGACA 105
mGAPDH ATGGTGAAGGTCGGTGTGAA TGGAAGATGGTGATGGGCTT 217
mLgr5 CTGAGACAGGTTCCGGAGGA GAGATGCAGAACCACGAGGC 276
mBmi1 CAAGCTGCCCGTCTATACCC AGAGGGGTAGGTGGCAAAGA 199
mDll1 CAGGACCTTCTTTCGCGTATG AAGGGGAATCGGATGGGGTT 168
mDll4 TTCCAGGCAACCTTCTCCGA ACTGCCGCTATTCTTGTCCC 102