Skip to main content

Table 1 Primer and probe sequences used in this study

From: Limitations of using feline coronavirus spike protein gene mutations to diagnose feline infectious peritonitis

Name Use Sequence (5′–3′)
P009 qPCR forward primer AGCAACTACTGCCACRGGAT
P010 qPCR reverse primer GGAAGGTTCATCTCCCCAGT
TaqMan-P1 FCoV qPCR fluorescent probe FAM-AATGGCCACACAGGGACAACGC-BHQ1
F614 Forward pyrosequencing primer GCHCARTATTAYAATGGCATAATGG
R766 Biotinylated reverse pyrosequencing primer BIO-AAGYCTRGCYTGYACTTGCAT
S680 M1058L pyrosequencing primer ACAGCCTCDTTAATAGGVGGTATG
S693A S1060A pyrosequencing primer TAGGRGGTATGGCYWTGG
FCoV S2 F1 Forward FCoV type 2 spike gene fragment amplification primer TCTGCTGCCATCAAAATCAC
FCoV S2 R3 Reverse FCoV type 2 spike gene fragment amplification primer CGATGTGTAAGCAATTGTCCA
  1. qPCR: quantitative polymerase chain reaction, FCoV: feline coronavirus, FAM: fluorescein amidite, BHQ1: black hole quencher-1, BIO: biotin.