Skip to main content

Table 1 Primer sequences for real-time RT-PCR

From: Recall T cell responses to bluetongue virus produce a narrowing of the T cell repertoire

Gene Forward (5′–3′) Reverse (5′–3′)
IL-6 CCTCCAGGAACCCAGCTATG GGAGACAGCGAGTGGACTGAA
IL-1β CGAACATGTCTTCCGTGATG TCTCTGTCCTGGGAGTTTGCAT
IL-12 CGTGATGGAAGCTGTGCAC CTTTCCTGGACCTGAACAC
CXCL10 GCTCATCACCCTGAGCTGTT AGCTGTCAGTAGCAAGGCTA