Skip to main content

Table 1 Primer sequences used for RT-PCR

From: Immunomodulation in the canine endometrium by uteropathogenic Escherichia coli

Gene Accession number Sequence (5′–3′) Annealing temperature (°C) Amplicon size (bp)
MyD88 XM_534223 FW-ACTATCGGCTGAAGTTGTGTGTGT
RV-TGGTGTAGTCACAGACAGTGATGAA
58.3 276
TRAM NM_001204337 FW-GGGTGTCAGGAAGTCGAAAATA
RV-CTGCGTGCAGTATCACAAACTT
56.8 266
TRAF6 XM_003432322 FW-AAACTGTGAAAACAGCTGTGGA
RV-CAGTTCATGCAAGAAACCTGTC
56.1 564
TRIF XM_849573 FW-CTTCCAAAGCCCATAGAGGA
RV-AAGCGGTGTCTTCTACAGGAA
55.4 487
IRF3 XM_005616307 FW-GGTGCCTACACTCCTGGAAA
RV-CTTCATCAGGCACCAAGAGC
56.0 418
NFkB NM_001003344 FW-TGTTTCACTTGGATCCTTTGAC
RV-AGATCCCATCCTCACAGTGTTT
55.4 327
IL- NM_001037971 FW-CACCAGTGAAATGATGGCTTAC
RV-CTCATGTGGAACACCACTTGTT
56.0 453
IL-6 NM_001003301 FW-GTACATCCTCGGCAAAATCTCT
RV-GGATGAGGTGAATTGTTGTGTG
56.0 410
IL-8 NM_001003200 FW-TTGGCAGCTTTTGTCCTT
RV-GGGCCACTGTCAATCACT
52.5 149
IL-10 NM_001003077 FW-AAGCTGGACAACATACTGCTGA
RV-TGTCAAACTCACTCATGGCTTT
56 310
TNF-α NM_001003244 FW-TGACAAGCCAGTAGCTCATGTT
RV-CGGCAAAGTCCAGATAGTTAGG
56 410
IL-2 NM_001003305 FW-TTGTCGCAAACAGTGCACCTA
RV-CCTGGAGAGTTGGGGGTTCT
60 131
IL-4 NM_001003159 FW- CTCACCAGCACCTTTGTCCA
RV- GTCAGCTCCATGCACGAGTC
60 107
IFN-β NM_001135787 FW- CAGTAGATGCATCCTCCAAACA
RV- GACTATTGTCCAGGCACAGATG
55.9 493
IFN-γ NM_001003174 FW-GCTGTAACTGTCAGGCCATGTTT
RV-TGTTTTGTCACTCTCCTCTCTCCA
60 140