Skip to main content

Table 1 Primers used for gene expression analyses

From: Experimental Piscine orthoreovirus infection mediates protection against pancreas disease in Atlantic salmon (Salmo salar)

Target name Sequence Amplicon length Genbank no.
Calsequestrin Fwd: ATCCAGATGACTTCCCGCTG
Rev: CTGGGGAGAGCCTAGGTCAAT
72 NM_001141681.1
Matrix metalloproteinase 13 Fwd: AGTGTCCAGCACAAATGACCT
Rev: CTCAACTGCTGATCCACTGGT
78 XM_014163130.1
Interleukin 1-receptor accessory protein-like 2 Fwd:CTGGCTGGTCAATGGGACAT
Rev: GTGGACCTGAAGTCCTCTGC
144 XM_014137694.1
Neuropeptide Y1 Fwd: GCTACCCGGTCAAACCTGAA
Rev: GGACTGTGGGAGCGTATCTG
194 XM_014178359.1
Serum amyloid A5 protein Fwd: GGTGCTAAAGACATGTGGCG
Rev: CCACTGGAACCCTGAACCAT
173 NM_001146565.1
Arginase 1 Fwd: TGGCGATGTGCCTTTGATTT
Rev: ATCCCGCGGTTGTCCTTTT
208 NM_001141316.2
Arginase 2—mitochondrial Fwd: AACACAGGGTTGTTGTCGGT
Rev: AGAGTCGAAGCTGTTCCGTG
193 XM_014211724.1