Skip to main content

Table 2 Details of selected potential reference genes

From: The 60S ribosomal protein L13 is the most preferable reference gene to investigate gene expression in selected organs from turkeys and chickens, in context of different infection models

Gene/symbol Protein Physiological functions Accession number for chicken Accession number for turkey Primer and probe sequences (F-forward primer; R-reverse primer; P-probe)
TFRC Transferrin receptor protein Cellular uptake of iron NM_205256.2 XM_003209136.2 F:AGCTGTGGGTGCTACTGAA
R:GGCAGAAATCTTGACATGG
P:HEX-CTCTGCCATGCTGCATGCCA-BHQ1
TBP Binding protein TATA box Transcription factor NM_205103.1 XM_010707033.1 F:CTGGGATAGTGCCACAGCTA
R:GCACGAAGTGCAATGGTTT
P:ROX-TGCAACCAAGATTCACCGTGGA-BHQ2
HPRT1 Hypoxanthine–guanine phosphoribosyl-transferase I Enzyme in the purine pathway NM_204848.1 XM_010715191.1 F:GCTCATCATGGACAGGACAG
R:CACAGAGAGCTACAATGTGGTG
P:CY5-TGCCCTTCATAATTTCACGTGCCA-BHQ3
VIM Vimentin Cytoskeletal component responsible for maintaining cell integrity NM_001048076.1 XM_010712706.1 F-TGAGTCCCTGCAAGAAGAAA
R:CAGGGCAGCAGTAAGATCAG
P:ROX-TCCGGGAACTGCAGGCTCAA-BHQ2
RPS7 40S acidic ribosomal protein S7 Small ribosomal subunit XM_004940516.1 NM_001285787.1 F-TGGTATATCCCAGGCTCTCC
R-TCAGCTGAGGAACTGGTACG
P:FAM-TCAACTCCCGCAGCTGAGCC-TAM
RPL13 60S ribosomal protein L13 Large ribosomal subunit NM_204999.1 XM_010718177.1 F:GGAGGAGAAGAACTTCAAGGC
R:CCAAAGAGACGAGCGTTTG
P:HEX-CTTTGCCAGCCTGCGCATG-BHQ1
HMBS Hydroxymethyl-bilane synthase Production of heme XM_417846.5 XM_010723546.1 F:CCTGCCAACTTCTCTTCCTC
R:CAACAGCATCAAGTGGGTTC
P:FAM-TGCAAATAGCACCAATGGTAAAGCCA-TAM
RPLP0 60S acidic ribosomal protein P0 Large ribosomal subunit NM_204987.2 XM_003211079.2 F-CAATGGCAGCATTTACAACC
R:CAGGAAACGCTTGTGCAG
P:CY5-TCTCCTCAGTGATGTCCAGCACTTCA-BHQ3