Skip to main content

Table 1 Primers used in qRT-PCR

From: Helicobacter suis affects the health and function of porcine gastric parietal cells

Gene Primer Sequence (5′-3′) Reference
Atp4a Sense GCATATGAGAAGGCCGAGAG [27]
Antisense TGGCCGTGAAGTAGTCAGTG
Sonic hedgehog Sense TGACCCCTTTAGCCTACAAGCA This study
Antisense TGGGGGTGAGTTCCTTAAATCG