Skip to main content

Table 2 Primers used in the study

From: Pyruvate kinase is necessary for Brucella abortus full virulence in BALB/c mouse

Primers Oligonucleotide sequence (5′ to 3′) Target genes Products (bp)
Cpyk-F GGGGTACCTTGTCCAATATAAAGCGATGAC KpnI, underlined The pyk containing the promoter region 1934
Cpyk-R CGGGATCCAATGCCGGATTTTCCGTCAGCG BamHI, underlined
3 × Flag-R GCTCTAGACAGGGATGCCACCCGGGATC XbaI, underlined The 3 × Flag tag of p3 × Flag-CMV-14  
pyk-UF CGGGATCCCGGGGGTTATGGAAAGCAACT The upstream fragment of pyk 947
pyk-UR TGACGACGCAATGCAGGCTCGAGGGTGAAGGTCTGG
pyk -DF CCAGACCTTCACCCTCGAGCCTGCATTGCGTCGTCA The downstream fragment of pyk 995
pyk- DR CGGGATCCCGTACGGGTGCGGGTGTTTC
In-pyk-F ATGCCGTGCTGAAGGAAGAG The inside fragment of pyk gene 493
In-pyk-R GCGTCAATGATGGTCGAATAGG
Out-pyk-F GGGGTACCCCGACGGTGGGAAGGCAAAG The outside fragment of pyk gene 1885
Out-pyk-R CGGGATCCCGGAGCGGCTCCAGAAATCG
RT-pyk-F AAAACTGCATCTGGTGGCTG pyk 207
RT-pyk-R GGGCGCTGGATAAAGGAAAG
RT-upstream-F ATGACATCAATCGCACGCTG bab_RS24315 161
RT-upstream-R GAAATTCTTTTGGGCGTCGC
RT-downstream-F AAGCTGCAAAACCCTGATCG bab_RS24325 209
RT-downstream-R AGCTTGATTGTTCCCCGGTA
RT-GAPDH-F GACATTCAGGTCGTCGCCATCA gapdh 188
RT-GAPDH-R TCTTCCTTCCACGGCAGTTCGG