Skip to main content

Table 1 Primers for qRT-PCR

From: Baicalin suppresses NLRP3 inflammasome and nuclear factor-kappa B (NF-κB) signaling during Haemophilus parasuis infection

Gene Nucleotide sequence (5′–3′) Tm (°C) Length (bp)
β-actin Forward TGCGGGACATCAAGGAGAAG 57.4 216
Reverse AGTTGAAGGTGGTCTCGTGG 57.4
NLRP3 Forward GGAGGAGGAGGAAGAGGAGATA 59.5 147
Reverse AGGACTGAGAAGATGCCACTAC 57.7
ASC Forward ACAACAAACCAGCACTGCAC 55.4 126
Reverse CTGCCTGGTACTGCTCTTCC 59.5
Caspase-1 Forward GAAGGAGAAGAGGAGGCTGTT 57.6 268
Reverse AGATTGTGAACCTGTGGAGAGT 55.8
IL-1β Forward TCTGCATGAGCTTTGTGCAAG 55.6 225
Reverse ACAGGGCAGACTCGAATTCAAC 57.7
IL-18 Forward AGTAACCATCTCTGTGCAGTGT 55.8 155
Reverse TCTTATCATCATGTCCAGGAAC 53.9
TNF-α Forward CGCTCTTCTGCCTACTGCACTTC 61.3 164
Reverse CTGTCCCTCGGCTTTGACATT 57.6
IL-6 Forward CCAGGAACCCAGCTATGAAC 57.4 142
Reverse CTGCACAGCCTCGACATT 54.9
IL-8 Forward CAGAGCCAGGAAGAGACT 54.9 461
Reverse GACCAGCACAGGAATGAG 54.9
IL-10 Forward GCATCCACTTCCAGGCCA 57.2 176
Reverse CTTCCTCATCTTCATCGTCA 53.4
COX-2 Forward CTGTCCCATCCCTCGGTTTA 54.4 105
Reverse TCTCTGAGCACTGTCCGTAAT 54.4