Skip to main content

Table 1 Details of the recombinant P. ovis antigens used in the vaccine cocktail

From: A recombinant subunit vaccine for the control of ovine psoroptic mange (sheep scab)

P. ovis antigen Accession No. Reference Soluble in PBS a Molecular weight (kDa) b Expression system
Cathepsin L BQ834906.1 [23] No 25 E. coli BL21-Codon Plus—pET-22b(+)
muGST AM991140.1 [14] Yes 25 E. coli BL21-Codon Plus—pET-22b(+)
Pso o 1 AM269885.1 [21] Yes 25 P. pastoris-X-33-pPICZαC
Pso o 2 AF187083.1 [24] No 14 E. coli BL21-Codon Plus—pET-22b(+)
Pso o 3 c d, e No 25 E. coli BL21-Codon Plus—pET-22b(+)
Pso o 10 AM114276.1 [20] Yes 37 E. coli BL21-Codon Plus—pET-22b(+)
Cyclophilin AAP03083.1 d, f Yes 38 E. coli BL21-Codon Plus—pET-SUMO
  1. aPso o 1, Pso o 10, cyclophilin and muGST were soluble in PBS, whilst Pso o 2, Pso o 3 and cathepsin L were formulated in Dialysis Buffer (DB).
  2. bPredicted molecular weight in kilo Daltons.
  3. cNot yet assigned.
  4. dUnpublished data.
  5. ePso o 3 identified as a homologue of the house dust mite allergen Der p 3 in an EST from a P. ovis cDNA library. The following primer sequences were used to amplify the coding region of Pso o 3, from cDNA derived from mixed stage P. ovis as described in [20], downstream of the predicted signal peptide sequence, and to allow subcloning into the expression vector (restriction sites underlined) :Pso o 3-For 5′ GATCCGAATTCGGCATATCGAATGTTTCCACTTCC3′, Pso o 3-Rev-5′ CCGCAAGCTTTACGATTCCGACAATCGTTTTAC3′.
  6. f P. ovis cyclophilin identified as an EST from a P. ovis cDNA library. The following primer sequences were used to amplify full length P. ovis cyclophilin from cDNA derived from mixed stage P. ovis as described in [20] : Cyclophilin-For 5′ATGTCAACATGGACCCAAATTCAA′3, Cyclophilin-Rev 5′TTACATTTCACCACATTGTGATATGAT3′. Cyclophilin was subsequently expressed in E. coli, confirmed by matrix assisted laser desorption ionisation mass spectroscopy and its peptidyl prolyl cistrans isomerase (PPIase) activity confirmed by a coupled enzyme assay as described in [41].