Skip to main content

Table 2 Primer sets used for real-time PCR

From: Expression of cytokine and apoptosis-related genes in bovine peripheral blood mononuclear cells stimulated with Brucella abortus recombinant proteins

Gene Primer sequence (5′–3′) Annealing temperature (°C) Product size (bp) Reference
iNOS F: AGCGGAGTGACTTTCCAAGA 55 97 [40]
R: TTTTGGGGTTCATGATGGAT
IL-1β F: ACCTTCATTGCCCAGGTTTCT 55 120 [40]
R: TGTTTGGGGTCATCAGCCTCAA
IL-4 F: CAAAGAACACAACTAAGAAG 55 181 [40]
R: AGGTCTTTCAGCGTACTTGT
IL-6 F: TCCAGAATGAGTATGAGG 55 236 [40]
R: CATCCGAATAGCTCTCAG
IL-12p40 F: AACCTGCAACTGAGACCATT 55 186 [40]
R: ATCCTTGTGGCATGTGACTT
IFN-γ F: ATAACCAGGTCATTCAAAGG 55 218 [40]
R: ATTCTGACTTCTCTTCCGCT
TNF-α F: TAACAAGCCAGTAGCCCACG 55 277 [40]
R: GCAAGGGCTCTTGATGGCAGA
Bax F: TCTCCCCGAGAGGTCTTTTT 55 151 [41]
R: TGATGGTCCTGATCAACTCG
Bcl-2 F: ATGTGTGTGGAGAGCGTCAA 55 146 [41]
R: CTAGGGCCATACAGCTCCAC
TLR4 F: TGACATCTTCACAGAACTGACTA 55 164 This study
R: GGAGTGGTTCATAAAGAAATGTA
β-actin F: CGCACCACTGGCATTGTCAT 60 227 [42]
R: TCCAAGGCGACGTAGCAGAG