Skip to main content

Table 1 Primer sequences for cloning Brucella abortus genes

From: Expression of cytokine and apoptosis-related genes in bovine peripheral blood mononuclear cells stimulated with Brucella abortus recombinant proteins

Gene Primer sequence (5′–3′) Annealing temperature (°C) Product size (bp)
Outer membrane protein 28 F: GATCGGATCCAACACTCGTGCTAGCAATTTT 63 753
R: GATCAAGCTTTTACTTGATTTCAAAAACGAC
Malate dehydrogenase F: AATTCGGATCCATGGCACGCAACAAGATT 63 963
R: AGGCGTCGACTTATTTCAGCGACGGAGC
Elongation factor F: AATTCGAATTCATGAGCATTTCCGCATCT 63 918
R: AGGCCTGCAGTCAGCCCTTGGCGGCTGCGGC
Arginase F: AGCGCGGATCCATGCATTGTAAGATTCTG 63 918
R: AGGCCTGCAGTCAATAGCTGATGGTCGG
Metal-dependent hydrolase F: AGCGCGGATCCATGCATTGTAAGATTCTG 63 711
R: AGCGCTGCAGTTAAGCTTGGAAGCTGTG