Skip to main content

Table 1 Expression plasmids.

From: The non-structural protein μNS of piscine orthoreovirus (PRV) forms viral factory-like structures

Plasmid name Primer Sequence (5ʹ → 3ʹ)
pcDNA3.1-μNS-N-FLAG Forward GCCGCTCGAGTCTAGAGCCACCATG GACTACAAAGACGATGACGACAAGATGGCTGAATCAATTACTTTTG
Reverse AAACGGGCCCTCTAGATCAGCCACGTAGCACATTATTCAC
pcDNA3.1-μNS-C-FLAG Forward GCCGCTCGAGTCTAGAGCCACCATGCGCAAGCTGGACTTGGTTGCA
Reverse AAACGGGCCCTCTAGATCACTTGTCGTCATCGTCTTTGTAGTCGCCACGTAGCACATTATTCACGCC
pcDNA3.1-σNS-N-MYC Forward GCCGCTCGAGTCTAGAGCCACCATG GAACAAAAACTCATCTCAGAAGAGGATCTGATGTCGAACTTTGATCTTGG
Reverse AAACGGGCCCTCTAGACTAACAAAACATGGCCATGA
pcDNA3.1-σNS-C-MYC Forward GCCGCTCGAGTCTAGAGCCACCATGTCGAACTTTGATCTTGG
Reverse AAACGGGCCCTCTAGACTACAGATCCTCTTCTGAGATGAGTTTTTGTTCACAAAACATGGCCATGATGC
pcDNA3.1-μ2-C-HA Forward GGCGGCCGCTCGAGTCTAGAATGCCTATCATAAACCTGCC
Reverse GTTTAAACGGGCCCTCTAGAAGCGTAATCTGGAACATCGTATGGGTACTCACCAGCTGTAGACCACC
pcDNA3.1- λ1-N-HA Forward CGCTCGAGTCTAGAGCCACCATG TACCCATACGATGTTCCAGATTACGCTATGGAGCGACTTAAGAGGAAAG
Reverse AAACGGGCCCTCTAGATTAGTTGAGTACAGGATGAG
pcDNA3.1-μNSΔ743-753 Forward GCCGCTCGAGTCTAGAGCCACCATG GACTACAAAGACGATGACGACAAGATGGCTGAATCAATTACTTTTG
Reverse AAACGGGCCCTCTAGATCACCAGTCATCTGAGCCACCAAA
pcDNA3.1-μNSΔ736-752 Forward GCCGCTCGAGTCTAGAGCCACCATG GACTACAAAGACGATGACGACAAGATGGCTGAATCAATTACTTTTG
Reverse AAACGGGCCCTCTAGATCAGTCGATGATTTTTGGAAACTC
pcDNA3.1-μNSΔ1-401 Forward GCCGCTCGAGTCTAGAGCCACCATGCCAACCACCTGGTATTCAAC
Reverse AAACGGGCCCTCTAGATCACTTGTCGTCATCGTCTTTGTAGTCGCCACGTAGCACATTATTCACGCC
pcDNA3.1-μNSΔ402-752 Forward GCCGCTCGAGTCTAGAGCCACCATG GACTACAAAGACGATGACGACAAGATGGCTGAATCAATTACTTTTG
Reverse AAACGGGCCCTCTAGATCATGTGGTCAGGGAATAGTGCAT
  1. Primers used in generating the constructs encoding PRV μNS (M3), σNS (S3), μ2 (M1) and λ1 (L3) and truncated versions of μNS.
  2. Start codons are marked in bold and epitope tags in italic.