Skip to main content

Table 1 Primers used in this study.

From: Role of the IFN I system against the VHSV infection in juvenile Senegalese sole (Solea senegalensis)

Gene Primer name Primer sequence (5′–3′) Amplicon size (bp)
Ubq Sole UBQ-Fa AGCTGGCCCAGAAATATAACTGCGACA 93
  SoleUBQ-Ra ACTTCTTCTTGCGGCAGTTGACAGCAC  
Rps4 SoleRPS4-Fa GTGAAGAGCTCCTTGTCGGCACCA 83
  SoleRPS4-Ra AGGGGGTCGGGGTAGCGGATG  
Mx SoleMxFb CCTCTCTCCTTCAGGATCCTCCTCCTGTGC 113
  SoleMxRb CAAAACAAGAAACTATCTGCCTGGTGGTTC  
Isg15 SoleISG15-Fc GATCTGAGCGACGACACCAA 150
  SoleISG15-Rc CTCGTCAGGTGATGTCATAGG  
Pkr SolePKR-Fc GAGTACAAGGGAACCCCGTCTT 150
  SolePKR-Rc GGCATCGTCCCAAATCTGTT  
VHSV VHSV-F1d AAGGCCCTCTATGCGTTCATC 122
nucleoprotein VHSV-R1d GGTGAACAACCCAATCATGGT  
  1. a[54]
  2. b [27]
  3. c This study, these primers have been designed according to the sequence published in the transcriptome database for Senegalese sole, SoleaDB [55]
  4. d[28]