Skip to main content

Table 1 Primers covering gag, pol, LTR and env regions, were used for the SRLV detection by PCR

From: Post-entry blockade of small ruminant lentiviruses by wild ruminants

PCR assay Primers Sequence 5′–3′ References
Gag nested PCR GAG F1 TGG TGA RKC TAG MTA GAG ACA TGG [64]
  GAG F2 CAA ACW GTR GCA ATG CAG CAT GG  
  POL R1 CAT AGG RGG HGC GGA CGG CAS CA  
  POL R2 GCG GAC GGC ASC ACA CG  
Pol nested PCR P28 CAT GAA GAG GGG ACA AAT CAG CA [18]
  P34 TAC ATT GGG TGC CTG GAC ATA A  
  P32 TAC CTG DGT TGG TCC YWG CCA CT  
  P33 CTT CCC AVA GTA CCT GDG TTG GTC  
  P29 GGT GCC TGG ACA TAA AGG GAT TC  
  P35 GCC ACT CTC CTG RAT GTC CTC T  
Gag-Can nested PCR CAEV F0 AAC TGA AAC TTC GGG GAC GCC TG [5]
  CAEV F1 AAG GTA AGT GAC TCT GCT GTA CGC  
  CAEV F2 TGG TGA GTC TAG ATA GAG ACA TGG  
  CAEV R0 GTTATCTCGTCCTAATACTTCTACTGG  
  CAEV R1 TTT TTC TCC TTC TAC TAT TCC YCC  
  CAEV R2 GGA CGG CAC CAC ACG TAK CCC  
  MVV F0 AAG TAA GGT AAG AGA GAC ACC TAC TGG  
  MVV F1 TAG ATA GAG ACA TGG CGA AGC AAG CTC  
  MVV F2 GAC AGA AGG GAA CTG TCT ATG GGC  
  MVV R0 GGT GGT GCT TCT GTT ACA ACA TAG G  
  MVV R1 GGA CGG CAC CAC ACG TGG  
  MVV R2 CCC CTC CTG YTG TTT CCC TG  
BIV nested PCR POL3 ACA ACG GGC CGT GCT TTA CTG [65]; [66]
  POL4 CCT CTT CCT CTA TTA CTG CTG C  
  POL5 GAR AAT CTA TGT AAG TAT CTG GG Unpublished data (Nadin-Davis)
  POL6 CTG TTY CTT ACG TAA CAC CAC T  
  P09 CAC TGG ACG AGA TGA GGT AGT [67]
  P06 TGG TAG TCT GAT AAA TGG CA  
  P04 CAG GCT CTT AAG GAA ATT GT  
  P11 CCA TCC TTG TGG TAG AAC ATT  
Craft-Oslo Craft-Fw TGA CAG AAG GAA ATT GTY TRT GG  
  Oslo-Rv GGC ATC ATG GCT AAT ACT TCT AA [68]
LTR PCR LTR-Fw TGA CAC AGC AAA TGT AAC CGC AAG [69]
  LTR-Rv CCA CGT TGG GCG CCA GCT GCG AGA  
CO qPCR 612-F GAA CTC AGC CAC AAG AGG AAG AA [70]
  613-R CCT GCG GCA GCT ACT ATT GC  
  614 Probe FAM AACTAGCATAATGACCAAGCCAACGCCTCT BHQ-1  
A4 qPCR Fs7631/Fg6221 ACA AAC TGG ACC ACC ATG CA [21]
  Rg6221 CTA GTG TTC CAT TTC CTG TTC TGT TTA  
  Probe g6221 FAM GGC AAC TGT TCW CAG TGT GTT AAT GYA ACG BHQ-1  
A4-SU PCR SU5-1F GTA GAT GTG TAC AAA GAC CAG [21]
  SU5-1R CTG CCT CTA ACA CTT GCT GC  
CO-SU PCR B1-SU5-1R TGC CTC TAA CAC ATC CTG CTG TGC [70]
  B1-SU5-1F GGT GGA ACA TAT GAC AGG AG  
  1. Primers able to amplify bovine inmunodeficiency virus were included