Skip to main content

Table 2 Primers and functional categories of the analyzed immune-related genes.

From: Can selection for resistance to OsHV-1 infection modify susceptibility to Vibrio aestuarianus infection in Crassostrea gigas? First insights from experimental challenges using primary and successive exposures

Gene number Functional category Name Sense primer AntiSense primer
72 Immune response Metallothionein a CAGCTCACACAGTCCCTTC CATGTACAGTTACACGATGC
122 Immune response Universal stress protein TTGAGGTTTCCGTGAACGAG AACAATCACCGGAACTGACG
130 Immune response Interferon-induced protein 44 AAGATCCAACGATGAAAGAC TTGTCGACATCACTACAAAC
163 Immune response Big defensin TTCGCCTGCTTCCATACTGG GTCATGGTCACTCCTTATTC
189 Immune response C-type lectin 2 like protein GTCATCTGACCACAATTACAG TCGATAGCAGCATTCCAGAG
220 Immune response MyD88 adaptor AGGTACCGGCTGTGATACGA TTCAAACGCCACCAAGACTG
234 Immune response Tumor necrosis factor ligand superfamily GGATACGCAAGAGGAACTGC TGGACATTAACGACACGCGC
293 Immune response Interleukin 17 ACTGAGGCTCGATGCAAGTG AGCCTTCTTGCTTCATGTGG
300 Immune response Heat shock protein 70 GCATGTGAGCGAGCAAAACG TGGCAGCTTGAACAGCAGC
303 Immune response Galectin ACGAAACGCTCTGATTGGTG TTAGTGGCATGGTAGGTCTG
304 Immune response L-rhamnose-binding lectin AGATGATTGTGAAAGCAGCGA ACTGTAGCGGTCATGCTCTG
306 Immune response Proline rich protein CACCATGTTCTCTCGGAGGA GTCTGCAATGTTAACCCTCAG
307 Immune response Hemocyte defensin GTTGTAGAGCGGGCTACTGTG CTTGGTCAGATTCAGACTGG
351 Immune response Metallothionein b GGAACTGTAGCTGTGGAGAC CCTTCTTACAGCAGCAGTCG
399 Immune response Metallothionein c ATGTCCGATCATTGTTCCTG ACAGGTTTCTGGTCCGTGAC
8 Cellular differentiation Angiopoietin-1 receptor a TGACGTGCTCGGCAACATGC CATTGTGTCCCCGTGAAGCC
312 Cellular differentiation Angiopoietin-1 receptor b CGAAATCGTCTTACGAACGC GTTAGCAAGATCCCGTTGAG
324 Cellular differentiation Early growth response protein CTACCTCCACAAGCGACATG ACGTCGTTACTATGTGAGGG
216 Cellular differentiation Placental protein 11 GCCAGATTTACCTGGAATGG ATGCGGTGTAGATAGCGATG
375 Cellular differentiation GTP-binding protein Di-Ras2 TTGGGCGTACAGTGACAACC TCTCTGTTTCCTCGTGAACC
396 Cytoskeleton reorganization Acyl-CoA desaturase AGATGCAGACCCACACAACG GCGTTCCAAAGTGATTCTCC
401 Cytoskeleton reorganization Neurotrypsin AAACAATGCAAGGGAGAAGC CTATTGTCAGCACAATCTGG
441 Cytoskeleton reorganization Major vault protein TTCAAGAGTCAAGTGGATGC ACCATTGGCGGTATTGAAGG
439 Cytoskeleton reorganization Myosin essential light chain TACATAACGGGTCATGAGAC CAACACTGGATTACCACCTG
348 Cytoskeleton reorganization Calcineurin subunit B isoform 1 ACGGTGTATTCCTTGTGTCC TCTTCTGTACATGCAAGTGG
284 Cell adhesion-communication Integrin beta-PS CCCACCTAGTGCCAGTCAAG GAACTTTGACTTGTGTGACGT
420 Cell adhesion-communication Hemagglutinin/amebocyte aggregation factor precursor TCGTGAATGCTGAACACACC TACACCTGTCCAAACCAAGG
283 Respiratory chain Extracellular superoxide dismutase AGAGGTGAATGCTACCAGG AGGCCAAGAATTCCGTCTG
422 Respiratory chain Glutathione transferase omega-1 TTGGACAGGTTACCACACAG CAAACCAAGGCCATACCATG
378 Pro- and anti-apoptosis Caspase 7 AGGGAGACAAGCGCCGTCAG TCCTCATTTGCTCTTCGTTC
166 No hit Unknown gene product 166 AAGTCGTATAGGAGCACAGG GGCTGAGAACATAATCCTCC