Skip to main content

Table 1 List of genes and sequences of the primers used for qPCR analysis.

From: Live attenuated African swine fever viruses as ideal tools to dissect the mechanisms involved in viral pathogenesis and immune protection

Gene name Forward primer (5′ → 3′) Reverse primer (5′ → 3′) Accession number
β-actin CAGGTCATCACCATCGGCAACG GACAGCACCGTGTTGGCGTAGAGGT U07786
PPIA CCTGAACATACGGGTCCTG AACTGGGAACCGTTTGTGTTG AY266299
18S GACTCAACACGGGAAACCTCAC GCTTATGACCCGCACTTACTGG AY265350
TNFα CCTCTTCTCCTTCCTCCTG CCTCGGCTTTGACATTGG X57321
IL- GGCCGCCAAGATATAACTGA GGACCTCTGGGTATGGCTTTC NM_214055
IL-4 TTGCTGCCCCAGAGAAC TGTCAAGTCCGCTCAGG AY294020
IL-5 TGGTGGCAGAGACCTTGACA CCATCGCCTATCAGCAGAGTT NM_214205.1
IL-6 TGGCTACTGCCTTCCCTACC CAGAGATTTTGCCGAGGATG NM_214399
IL-8 TTCGATGCCAGTGCATAAATA CTGTACAACCTTCTGCACCCA AB057440
IL-10 CAGATGGGCGACTTGTTG ACAGGGCAGAAATTGATGAC L20001
IL-12p40 GGAGTATAAGAAGTACAGAGTGG GATGTCCCTGATGAAGAAGC U08317
IL-13 AAGTGGCCCAGTTCGTAAAAGA ACCCGTGGCGAAAAATCA NM_213803.1
IL-17A CTCTCGTGAAGGCGGGAAT TCCTCAGTTTTTGGGCATCCT NM_001005729
IL-18 AGGGACATCAAGCCGTGTTT CGGTCTGAGGTGCATTATCTGA EU118362.1
IL-21 CTGCCTGATGGTCATCTTCTCA AGGCGATCTTGTCCTTGGAA NM_214415
IL-23 GCTTGCAAAGGATCCACCAA GGCTCCCCTGTGAAAATGTC NM_001130236.1
IFN-γ CAAAGCCATCAGTGAACTCATCA TCTCTGGCCTTGGAACATAGTCT X53085
TGF-βR1 TCAGGCTTACCATTGCTTGTTCAG CTCGCCAAACCTCTCCAAATCG NM_001038639
DEFB1 ACCGCCTCCTCCTTGTATTC GGTGCCGATCTGTTTCATCT NM_213838
DEFB2 CTGTCTGCCTCCTCTCTTCC CAGGTCCCTTCAATCCTGTT NM_214442
NF-κB CTCGCACAAGGAGACATGAA ACTCAGCCGGAAGGCATTAT DQ834921
CD163 GCCTGTCTCATCGCATTCCT GGATTTAGCATATCCGTTTCATCTG NM_213976.1