Skip to main content

Advertisement

Table 1 List of the primers used in the qPCR assay

From: F4+ ETEC infection and oral immunization with F4 fimbriae elicits an IL-17-dominated immune response

Gene Sequence (5′→3′) Size (bp) Ta (°C) Reference
IL-17A F:ACTCCAAACGCTTCACCTCAC 234 58 NM_001005729.1
R:AGCCCACTGTCACCATCACTT
IL-17B-like F:CTGGCCAAGAGGAAGTGTGAG 92 60 XM_003124086.1
R:GGGTCGTGGTTGATGCTGTAG
IL-17F F:GAGGCAGCAGCTCGGAAAAT 173 60 NC_010449.4
R:TCCCGGGTGATGTTGTAATCC
IL-21 F:GGCACAGTGGCCCATAAATC 124 60 [30]
R:GCAGCAATTCAGGGTCCAAG
IL-22 F:TTGACCAGTCCAACTTCCAGCAGC 143 60 XM_001926156.1
R:GCAGCGCTCTCTCATATTGACTCC
IL-23p19 F:CCAAGAGAAGAGGGAGATGATGA 107 57 NM_001130236.1
R:TGCAAGCAGGACTGACTGTTGT
RORγt F:TTCAGTACGTGGTGGAGTTC 141 60 [30]
R:TGTGGTTGTCAGCGTTGTAG
IL-10 F : CCATGCCCAGCTCAGCACTG 295 60 [65]
R:CCCATCACTCTCTGCCTTCGG
IL-13 F:GTCATTGCTCTCACCTGCTT 308 58 [66]
R:TTGGTGTCTCGGATGTGCTT
GATA-3 F:GCTCTACCACAAAATGAACGGAC 110 58 NM_001044567.1
R:TCGTTGTGGTTTGACAGTTTGC
IL-12p40 F:GGTTTCAGACCCGACGAACTCT 112 60 [67]
R:CATATGGCCACAATGGGAGATG
IFN-γ F:GAGCCAAATTGTCTCCTTCTACT 262 60 [68]
R:CTGACTTCTCTTCCGCTTTCT
T-bet F:TCAATCCTACTGCCCACTAC 151 60 [69]
R:TTAGGAGACTCTGGGTGAAC
Foxp3 F:TGCCATTCGCCACAACTT 179 60 NM_001128438.1
R:CCTGTCCATCCTTCTTTCCTT
AID F:AGAAGTTTCAAAGCCTGGGAG 92 57 XM_003126511.1
R:TCAACCTCATACAGGGGCAAA
β-Actin F:TCATCACCATCGGCAACG 133 60 [70]
R:TTCCTGATGTCCACGTCGC
GAPDH F:GGGCATGAACCATGAGAAGT 230 60 [65]
R:AAGCAGGGATGATGTTCTGG
RPL19 F:AACTCCCGTCAGCAGATCC 147 60 [69]
R:AGTACCCTTCCGCTTACCG
  1. RORγt: RAR-related orphan receptor gamma t, AID: activation-induced (cytidine) deaminase, RPL-19: 60S ribosomal protein L19