Skip to main content

Table 1 Primer sets used to amplify and sequence E. rhusiopathiae housekeeping genes and genetic diversity of gene loci used for MLST analysis

From: A combinational approach of multilocus sequence typing and other molecular typing methods in unravelling the epidemiology of Erysipelothrix rhusiopathiae strains from poultry and mammals

Gene Primer sequence [5′-3′] Location within genea Amplicon size PCR (bp) Allele size MLST (bp) Mean GC content No. of alleles No. of variable sites (%) d N /d Sratio Simpsons index of diversity (D)
gpsA fw: AGTTATGATGTGGGGACG 75-745 671 540 38.3% 9 11 (2.0) 0.3610 0.608
rv: TAGCTGTAACGACGAGATCG
recA fw: TTCGGTAGAATAATCTCGCG 38-913 876 640 39.7% 9 13 (1.6) 0.0207 0.775
rv: TGCTATTAGTTCAGGGTCG
purA fw: GATGTTTATGAGGAAGCGC 331-1066 736 611 39.1% 14 11 (1.8) 0.5690 0.764
rv: AACGCATTGATTGTTGCCC
pta fw: TGCTGCAGTACGTTTAGC 90-793 704 544 36.6% 9 12 (2.2) 0.0419 0.579
rv: AGACACGTGCATTACCTG
prsA fw: ACAAGTTCACCAGTAAGTG 190-952 763 575 39.3% 6 4 (0.7) 0.0654 0.657
rv: AGAGTGTACTTACAGGAGT
galK fw: TATTCCTAATGGAGCGGG 357-1041 685 554 36.8% 13 10 (1.8) 0.0766 0.740
rv: AATCGCAATCGCACATCC
ldhA fw: AACGGATATGAAGCTGTTGCC 136-783 648 531 40.3% 11 14 (2.6) 0.3390 0.681
rv: AAGAACATCCAGTCCAACAGC
  1. aAs referred to E. rhusiopathiae ATCC 19414T (Acc.-No. NZ_ACLK02000001 - NZ_ACLK02000004).