Skip to main content

Table 1 Primers used for generating pBAC-C-KCE, donor plasmid pRThGA and identification of the pBAC-C-KCE-HA

From: Efficient strategy for constructing duck enteritis virus-based live attenuated vaccine against homologous and heterologous H5N1 avian influenza virus and duck enteritis virus infection

Purpose and primer Sequence (5’ → 3’) Sequence designation, restriction enzyme site and introduction sequence
BAC insertiona   
UL26-F aaagtcgac ataacttcgtatagcatacattatacgaagttatgccgtatgaatgcgctgac Sal I site (bold), Lox p sequence (italic)
UL26-R ttaattaacgcggacaaaacgacgattac Pac I site (bold)
gB-F gtaatcgtcgttttgtccgcgttaattaatgaaaaagacggcggtacaat Pac I site (bold)
gB-R aagaatgcattcggcctgg  
Red-F ccaggccgaatgcattcttcgtggggtgtggtgcttttggt  
Red-R tcgagcggccgc tagggataacagggtaatccccaccttatatattctttcccaccct Not I site (bold), I-isce I sequence (italic)
Amp-F aaattaattaaggggataacgcaggaaagaac Pac I site (bold)
Amp-R aaattaattaaacgtcaggtggcacttttcg Pac I site (bold)
Modification pRThGAb   
pCA-I-SceI-H1-F aaatagggataacagggtaat gttgagcctttttgtggagtgggttaaattgtactagcgcgtttcgctttgcagtacatctacgtattagtcatcgctatta I-isce I sequence (bold), Homology arm H1 (italic)
pCA-I-SceI-H2-R aaatagggataacagggtaat tagcatgcataacttcgtataatgtatgctatacgaagttatgcggccgc
I-isce I sequence (bold), Homology arm H2 (italic)
Amp t-I-SceI-F aaaattaccctgttatccctacacgttaagggattttggtcat I-isce I sequence (bold)
OriT-R6K-I-SceI-R aaaattaccctgttatcccta I-isce I sequence (bold)
Identification HAc   
BAC-F gagaacagaaaagaaagcgcgt  
BAC-R cgcagccacagaaaagaaacga  
  1. aPrimers used for the construction of the BAC insertion vector. The restriction are marked in italics. bPrimers used for modification of donor plasmid pRThGA. cPrimers used for verification HA gene insertion into pBAC-C-KCE base on MAGIC.