Skip to main content

Advertisement

Table 2 Potential miRNA target sites within the 3UTR of ZNF265 and R GS16 mRNA

From: Changes in cellular microRNA expression induced by porcine circovirus type 2-encoded proteins

Putative target gene miRNA miRNA-mRNA interaction Δ G (kcal/mol)
ZNF265 miR-139-5p target  5′  AGGAA––AUGAU–GCUGUAGAC 3′ −20.20
  | | | | | | | | | | | | | |
miRNA 3′  GACCUCUGUGCACGUGACAUCU 5′
RGS16 let-7b-5p target  5′  GAGCUGGCAGCCUGACUGGCUCC 3′ −28.00
    | | | || | | | | | | | | | | | |
miRNA 3′ UUGGUGUGUUGGA–UGAUGGAGU 5′
let-7c target  5′ GAGCUG–GCAGCCUGACUGGCUCC 3′ −24.20
  | | | | | | | | | | | | | | | | | | |
miRNA 3′  UUGGUAUGUUGGA–UGAUGGAGU 5′
let-7e target  5′  GAGCUG–GCAGCCUGACUGGCUCC 3′ −24.20
   | | | | | | | | | | | | | | | | | |
miRNA 3′   UUGAUAUGUUGGAG–GAUGGAGU 5′