Skip to main content

Table 2 Primers used for construction and sequencing of qPCR standards

From: Mycoplasma iowae: relationships among oxygen, virulence, and protection from oxidative stress

Primer name Target Sequence (5′-3′)
MIcards1up cards1 ATCGTCTGGTGCATATGCAACAGC
MIcards1down ATCGGCTCATGCAAGTGTTGCAGC
MIglpFup glpF ATCGGTAGTGCTTTTGCACTACAC
MIglpFdown ATCGCTTCCAATGATTCCACCTCC
MIkatEupSalI katE ATCGGTCGACAAATGCTGCAACAGCTGCAC
MIkatEdownSalI ATCGGTCGACTAAACACAAAATTTGATTTAATCAAAATTCATG
MIsodup sodA ATCGGAACTGGGCCAACAAATGAC
MIsoddown ATCGACTTCACATGTCAGTTAGGG
M13Forward Sequencing GTTGTAAAACGACGGCCACT
M13Reverse CAGGAAACAGCTATGACC