Skip to main content

Table 1 Primers used for qPCR experiments

From: Mycoplasma iowae: relationships among oxygen, virulence, and protection from oxidative stress

Primer Name Target Sequence (5′-3′) Tm (°C)
MI16Sleft(qPCR) 16S rRNA gene CGCAAGACTCACGAGCTTAT 54.6
MI16Sright(qPCR) GGTACAAACTGTCGCAAACC 54.4
MIcards1left(qPCR) cards1 (P271_571) TGGGTAGAAGCACAGACGTT 56.1
MIcards1right(qPCR) ACTCATCTGCATCTGGGTCA 55.8
MIglpFleft(qPCR) glpF (P271_673) ATCTAGCATGATGGGTGGCG 57.3
MIglpFright(qPCR) TGTCCAAACATTGCTCCTGT 54.7
MIkatEleft(qPCR) katE (P271_534) CGTGTAGTTCATCGAAAAGGTG 54.6
MIkatEright(qPCR) CTTCCAGCTTCACCACCAAC 56.3
MIsodleft(qPCR) sodA (P271_491) ACACAAAGCATCACCAAGCT 55.2
MIsodright(qPCR) TGATTGTGATGACCTCCACCA 56.1