Skip to main content

Table 2 PCR primers for amplification of the four genes on the plasmid that were absent in the “avirulent” B. hyodysenteriae strains but present in all the virulent strains

From: Absence of a set of plasmid-encoded genes is predictive of reduced pathogenic potential in Brachyspira hyodysenteriae

Primer nameb Sequence (5′ – 3′) Product size
BHWA1_02678a-F tagaaacggtaatcccattag 322 bp
BHWA1_02678a-R taaaagcgaagcattagtagtag  
BHWA1_02678b-F tgataaagtaaatagggtagatactactac 420 bp
BHWA1_02678b-R aaatacataaggacaaaccattac  
BHWA1_02678c-F ttttgctgaaatggtagagtatg 558 bp
BHWA1_02678c-R tatagtttttactgattctttattgacatc  
BHWA1_02679a-F ttggtggaggagttggtac 237 bp
BHWA1_02679a-R tgataaagaagaggatgattcc  
BHWA1_02679b-F tcaggtataaatccgcctaatg 495 bp
BHWA1_02679b-R caggtactaaaccagcagtcatag  
BHWA1_02679c-F ggttttatatgtaagaatgaagatg 329 bp
BHWA1_02679c-R cttagaatttgaagtccagtttg  
BHWA1_02680a-F gaagtttttggcataggaac 289 bp
BHWA1_02680a-R tcattttcttttaatggtgtatc  
BHWA1_02680b-F aaaaggctatttagaatctgaag 280 bp
BHWA1_02680b-R cattatctccataagtatagaaaactctac  
BHWA1_02680c-F tggtgatatagcaaaaagtatagc 183 bp
BHWA1_02680c-R ccctacaataattttaggttcttcag  
BHWA1_02681a-F gtgggaaaaataaatctgaag 345 bp
BHWA1_02681a-R gcttaattctacagtaaaatgctg  
BHWA1_02681b-F gtaatgatgaacttaaaaaatcaggtattg 266 bp
BHWA1_02681b-R attccatgagccacataaggag  
BHWA1_02681c-F aaacagtcaaatatgagttatagtgc 391 bp
BHWA1_02681c-R aaatctggtatacttttatccttttc  
  1. bPrimers named according to the plasmid gene they are designed to amplify.