Skip to main content

Table 1 Primer sequences used for real-time PCR analysis of mRNA expression of target and housekeeping genes

From: The innate immune response of equine bronchial epithelial cells is altered by training

Name Primer sequences forward/reverse (5′ to 3′) Product (bp) Exon Reference
PGK1 CGTCAAAGACCTGATGTCCA 98 1 In silico designed
TCTTGGCATGCTCATCAAAC
PPIA TGGGGAGAAATTTGATGATGA 116 1 In silico designed
TGGCAGTGCAGATGAAGAAC
RPL0 CCAAGGTTGAAGCAAAGGAA 99 1 [13]
AAAGCTGGCTGAATTGGTTG
FGF-1 AGAAGAATGGGAGCTGCAAA 138 1 In silico designed
GGACTCCTTCAGGCTCCTCT
FSP-1 GCCCTGGATGTGATGGTATC 93 1 In silico designed
CAGCAGCTCCTTTAGCTCTGA
E-cadherin ATCCGCAGCCTCATATCATC 125 1 In silico designed
CCCACCTGGGTCATTGTACT
Keratin19 GAAGGAGACCATGCAGAACC 120 1 In silico designed
CCCTGCTTCAGGTACCAGTC
IFN-beta CCCCGAGGACACAATGAACT 81 1 In silico designed
ACCAATGCAGCATCCTCCTT
TNF-alpha AAGGACATCATGAGCACTGAA 80 1 In silico designed
GGGCCCCCTGCCTTCT
IL-6 CCTGGTGATGGCTACTGCTT 102 1 In silico designed
TGCTGTTTGGTTTTGTCTGC
CXCL8 TTGGCCGTCTTCCTGCTTT 101 2 Intron (959 bp) In silico designed
GGTTTGGAGTGCGTCTTGATG